Search results for "vectorization"
Items we need to order for you
Finite-Dimensional Vector Spaces
From the reviews: "The theory is systematically developed by the axiomatic method that has, since von Neumann, dominated the general approach to linear functional analysis and that achieves here a high degree of lucidity and clarity....The book contains about 350 well placed and instructive problems, which cover a considerable part of the subject. All in all this is an excellent work, of equally high value for both student and teacher." --ZENTRALBLATT FÜR MATHEMATIK
R 1,675.32
V-Invex Functions and Vector Optimization
This volume summarizes and synthesizes an aspect of research work that has been done in the area of Generalized Convexity over the past few decades. Specifically, the book focuses on V-invex functions in vector optimization that have grown out of the work of Jeyakumar and Mond in the 1990’s. The authors integrate related research into the book and demonstrate the wide context from which the area has grown and continues to grow.
R 2,015.00
Finite-Dimensional Vector Spaces
From the reviews: "The theory is systematically developed by the axiomatic method that has, since von Neumann, dominated the general approach to linear functional analysis and that achieves here a high degree of lucidity and clarity....The book contains about 350 well placed and instructive problems, which cover a considerable part of the subject. All in all this is an excellent work, of equally high value for both student and teacher." --ZENTRALBLATT FÜR MATHEMATIK
R 1,675.61
Vector and Complex Calculus
Vector and complex calculus are essential for applications to electromagnetism, fluid and solid mechanics, and the differential geometry of surfaces. Moving beyond the limits of standard multivariable calculus courses, this comprehensive textbook takes students from the geometry and algebra of vectors, through to the key concepts and tools of vector calculus. Topics explored include the differential geometry of curves and surfaces, curvilinear coordinates, ending with a study of the essential elements of the calculus of functions of one complex variable. Vector and Complex Calculus is richly illustrated to help students develop a solid visual understanding of the material, and the tools and concepts explored are foundational for upper-level engineering and physics courses. Each chapter includes a section of exercises which lead the student to practice key concepts and explore further interesting results.
R 6,381.00
Calculus with Vectors
Calculus with Vectors grew out of a strong need for a beginning calculus textbook for undergraduates who intend to pursue careers in STEM fields. The approach introduces vector-valued functions from the start, emphasizing the connections between one-variable and multi-variable calculus. The text includes early vectors and early transcendentals and includes a rigorous but informal approach to vectors. Examples and focused applications are well presented along with an abundance of motivating exercises.The approaches taken to topics such as the derivation of the derivatives of sine and cosine, the approach to limits and the use of "tables" of integration have been modified from the standards seen in other textbooks in order to maximize the ease with which students may comprehend the material. Additionally, the material presented is intentionally non-specific to any software or hardware platform in order to accommodate the wide variety and rapid evolution of tools used. Technology is referenced in the text and is required for a good number of problems.
R 2,931.00
Topological Vector Spaces and Their Applications
This book gives a compact exposition of the fundamentals of the theory of locally convex topological vector spaces. Furthermore it contains a survey of the most important results of a more subtle nature, which cannot be regarded as basic, but knowledge which is useful for understanding applications. Finally, the book explores some of such applications connected with differential calculus and measure theory in infinite-dimensional spaces. These applications are a central aspect of the book, which is why it is different from the wide range of existing texts on topological vector spaces. Overall, this book develops differential and integral calculus on infinite-dimensional locally convex spaces by using methods and techniques of the theory of locally convex spaces. The target readership includes mathematicians and physicists whose research is related to infinite-dimensional analysis.
R 3,873.44
Introduction To The Geometrical Analysis Of Vector Fields, An: With Applications To Maximum Principles And Lie Groups
This book provides the reader with a gentle path through the multifaceted theory of vector fields, starting from the definitions and the basic properties of vector fields and flows, and ending with some of their countless applications, in the framework of what is nowadays called Geometrical Analysis. Once the background material is established, the applications mainly deal with the following meaningful settings:
R 5,974.14
R 374.00
R 1,496.45
Bifurcations of Planar Vector Fields
The book reports on recent work by the authors on the bifurcation structure of singular points of planar vector fields whose linear parts are nilpotent. The bifurcation diagrams of the most important codimension-three cases are studied in detail. The results presented reach the limits of what is currently known on the bifurcation theory of planar vector fields. While the treatment is geometric, special analytical tools using abelian integrals are needed, and are explicitly developed. The rescaling and normalization methods are improved for application here. The reader is assumed to be familiar with the elements of Bifurcation and Dynamical Systems Theory. The book is addressed to researchers and graduate students working in Ordinary Differential Equations and Dynamical Systems, as well as anyone modelling complex multiparametric phenomena.
R 1,950.62
R 1,008.41
R 611.00
R 886.00
Near Vector Spaces and Related Topics
Near Vector Spaces and Related Topics provides a systematic treatment of the introductory theory of near vector spaces, as well as a range of associated areas.Since many topics in nonlinear analysis rely on the properties established in topological vector space, the concepts and topics presented in this book may stir up the interest of some researchers working in mathematical analysis, especially nonlinear analysis, and thus may potentially open a new avenue of research. The main prerequisites for most of the material in this book are basic concepts of functional analysis, including the basic tools of topology.This book is accessible to senior undergraduate students in mathematics and may also be used as a graduate level text, or as a reference for researchers who work on the applications of nonlinear analysis.Features · Valuable resource for researchers and postgraduate students interested in the foundation of fuzzy sets and nonlinear analysis· Presents new, previously unpublished material on near vector spaces· Well-organized and comprehensive treatment of the subject.
R 11,215.68
Vector Optimization and Monotone Operators via Convex Duality
This book investigates several duality approaches for vector optimization problems, while also comparing them. Special attention is paid to duality for linear vector optimization problems, for which a vector dual that avoids the shortcomings of the classical ones is proposed. Moreover, the book addresses different efficiency concepts for vector optimization problems. Among the problems that appear when the framework is generalized by considering set-valued functions, an increasing interest is generated by those involving monotone operators, especially now that new methods for approaching them by means of convex analysis have been developed. Following this path, the book provides several results on different properties of sums of monotone operators.
R 4,996.48
Vector Mode in the Second-order Cosmological Perturbation Theory
This thesis sheds valuable new light on the second-order cosmological perturbation theory, extensively discussing it in the context of cosmic microwave background (CMB) fluctuations. It explores the observational consequences of the second-order vector mode, and addresses magnetic field generation and the weak lensing signatures, which are key phenomena of the vector mode. The author demonstrates that the second-order vector mode, which never appears at the linear-order level, naturally arises from the non-linear coupling of the first-order scalar modes. This leads to the remarkable statement that the vector-order mode clearly contributes to the generation of cosmological magnetic fields. Moreover, the weak lensing observations are shown to be accessible to the vector mode. On the basis of ongoing and forthcoming observations, the thesis concludes that the second-order vector mode is detectable.
R 4,569.96
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa- tion for activation of lymphokine genes.To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 * -96 -84 GGAGATTCCCC IL-2R (p55) ...
R 3,238.05
Vector Partitions, Visible Points and Ramanujan Functions
Vector Partitions, Visible Points and Ramanujan Functions offers a novel theory of Vector Partitions, though very much grounded in the long-established work of others, that could be developed as an extension to the existing theory of Integer Partitions. The book is suitable for graduate students in physics, applied mathematics, number theory and computational mathematics. It takes the reader up to research level, presenting new results alongside known classical results from integer partitions and areas of vector and multipartite partition theory. It also sets forth new directions for research for the more advanced reader.Above all, the intention of the book is to bring new inspiration to others who study mathematics and related areas. It is hoped that some new ideas will be launched to add value and insight into many of the classical and new theories surrounding partitions. The book is an appreciation of the many gifted authors of research into partitions over the past century and before, in the hope that more may come of this for future generations.FeaturesProvides a step-by-step guide through the known literature on Integer and Vector Partitions, and a focus on the not so well-known Visible Point Vector identitiesServes as a reference for graduate students and researchers in physics, applied mathematics, number theory and computational mathematicsOffers a variety of practical examples as well as sets of exercises suitable for students and researchers.
R 9,158.00
Vector Biology, Ecology and Control
Mir S. Mulla joined the faculty of the Entomology Department at the University of California, Riverside in 1956, only two years after the Riverside campus was established as an independent campus within the University of California system. Prior to his appointment, Mir received his B.S. from Cornell University and then moved to the University of California, Berkeley to pursue his graduate studies. His Ph.D. from Berkeley, awarded in 1955, completed his formal American education which was the purpose of his immigration from his native Kandahar in Afghanistan. In his over 50 years at Riverside, Mir has made an incalculable impact on vector biology both within the United States and in developing countries throughout the world. Within Southern California, Mir’s basic and applied research led to the rapid and sustainable control of mosquitoes and eye gnats in the Coachella Valley and so directly enabled this region to grow to the thriving, large community it is today. In 2006 his efforts in facilitating the development of the low desert of southern California were recognized through the dedication of the Mir S. Mulla Biological Control Facility by the Coachella Valley Mosquito and Vector Control District. His success has been so profound that it remains somewhat cryptic to the many who now reside in, visit, and enjoy, this region of California, oblivious to the insect problems that severely restrained development until Mir and his students ?rst applied their expertise many decades ago.
R 5,542.04
Multivariable and Vector Calculus
This book is designed primarily for undergraduates in mathematics, engineering, and the physical sciences. Rather than concentrating on technical skills, it focuses on a deeper understanding of the subject by providing many unusual and challenging examples. The basic topics of vector geometry, differentiation and integration in several variables are explored. Furthermore, it can be used to impower the mathematical knowledge for Artificial Intelligence (AI) concepts. It also provides numerous computer illustrations and tutorials using MATLAB® and Maple®, that bridge the gap between analysis and computation. Partial solutions and instructor ancillaries available for use as a textbook.FEATURESIncludes numerous computer illustrations and tutorials using MATLAB®and Maple® Covers the major topics of vector geometry, differentiation, and integration inseveral variablesInstructors' ancillaries available upon adoption
R 2,051.00
Viral Vector Approaches in Neurobiology and Brain Diseases
Aiming toward improvement in the safety, efficiency, and specificity of viral vectors for neurobiological research and clinical applications, Viral Vector Approaches in Neurobiology and Brain Diseases covers key aspects related to the use of viral vectors in neuroscience, with a major emphasis on basic mechanisms of synaptic plasticity, learning, and memory, as well as molecular neuropharmacology and experimental animal models of brain disorders. The volume begins by delving into features of the viral vectors currently available in neuroscience and their production methods, and it then continues onward to examples of successful applications of viral vector technology to psychiatric and memory research, current applications of viral vector technology in the context of neurological disorders, as well as various cutting-edge applications of viral vector technology to neuroscience, including optogenetics. Written for the Neuromethods series, the chapters of this book contain the kind of detailed description and implementation advice that promotes successful, repeatable results. Practical and up to date, Viral Vector Approaches in Neurobiology and Brain Diseases will be useful not only to neurobiologists wishing to routinely use viral vectors in the laboratory but also to experienced scientists needing detailed new protocols for a variety of experimental applications.
R 4,825.63
R 296.00
Vector Analysis Versus Vector Calculus
The aim of this book is to facilitate the use of Stokes' Theorem in applications. The text takes a differential geometric point of view and provides for the student a bridge between pure and applied mathematics by carefully building a formal rigorous development of the topic and following this through to concrete applications in two and three variables.Key topics include vectors and vector fields, line integrals, regular k-surfaces, flux of a vector field, orientation of a surface, differential forms, Stokes' theorem, and divergence theorem. This book is intended for upper undergraduate students who have completed a standard introduction to differential and integral calculus for functions of several variables. The book can also be useful to engineering and physics students who know how to handle the theorems of Green, Stokes and Gauss, but would like to explore the topic further.
R 3,297.00
R 1,221.00
Vector Calculus
INTRODUCTION. In course of an attempt to apply direct vector methods to certain problems of Electricity and Hydrodynamics, it was felt that, at least as a matter of consistency, the foundations of Vector Analysis ought to be placed on a basis independent of any reference to cartesian coordinates and the main theorems of that Analysis established directly from first principles. embodied in the present paper and an attempt is made here to develop the Differential and Integral Calculus of Vectors from a point of view which is believed to be new. In order to realise the special features of my presentation of the subject, it will be convenient to recall briefly the usual method of treatment. In any vector problem we are given certain relations among a number of vectors and we have to deduce some other relations which these same vectors satisfy.
R 310.00
Vector-Valued Functions and their Applications
This book is the first to be devoted to the theory of vector-valued functions with one variable. This theory is one of the fundamental tools employed in modern physics, the spectral theory of operators, approximation of analytic operators, analytic mappings between vectors, and vector-valued functions of several variables. The book contains three chapters devoted to the theory of normal functions, Hp-space, and vector-valued functions and their applications. Among the topics dealt with are the properties of complex functions in a complex plane and infinite-dimensional spaces, and the solution of vector-valued integral equations and boundary value problems by complex analysis and functional analysis, which involve methods which can be applied to problems in operations research and control theory. Much original research is included. This volume will be of interest to those whose work involves complex analysis and control theory, and can be recommended as a graduate text in these areas.
R 3,079.83
Vector and Parallel Processing - VECPAR'98
This book stands as the visible mark of VECPAR'98 - 3rd International Meeting on Vector and Parallel Processing, which was held in Porto (Portugal) from 21 to 23 June 1998. VECPAR'98 was the third of the VECPAR series of conferences initiatedin1993and organisedby FEUP, the FacultyofEngineering of the University of Porto. The conference programme comprised a total of 6 invited talks, 66 c- tributedpapers and18posters. Thecontributed papers andposters were selected from 120 extended abstracts originating from 27 countries. Outline of the book The book, with 7 chapters, contains 41 contributed papers and 6 invited talks. The 41 papers included in these proceedings result from the reviewing of all papers presented at the conference. Each of the ?rst 6 chapters includes 1 of the 6 invited talks of the conference, and related papers. Chapters 1, 2, 4, 5 and 7 are initiated by an introductory text providing the reader with a guide to the chapter contents. Chapter 1 is on numerical algebra.It begins with an introductory text by - cente Hern'andez, followedby the invited talk by Gene Golub, entitled Some - usual Eigenvalue Problems.The remaining11contributed articles in thischapter deal either with large scale eigenvalue problems or with linear system problems.Computational?uiddynamicsandcrashandstructural analysiswere brought under the same chapter and that is Chapter 2, which contains the invited talk byTimothyBarth, entitledParallel Domain Decomposition Pre-conditioning for Computational Fluid Dynamics, plus 8 contributed papers. Timothy Barth also authors the introductory text to the chapter.
R 3,107.28
Normal Forms and Bifurcation of Planar Vector Fields
This book is concerned with the bifurcation theory, the study of the changes in the structures of the solution of ordinary differential equations as parameters of the model vary. The theory has developed rapidly over the past two decades. Chapters 1 and 2 of the book introduce two systematic methods of simplifying equations: centre manifold theory and normal form theory, by which the dimension of equations may be reduced and the forms changed so that they are as simple as possible. Chapters 3–5 of the book study in considerable detail the bifurcation of those one- or two-dimensional equations with one, two or several parameters. This book is aimed at mathematicians and graduate students interested in dynamical systems, ordinary differential equations and/or bifurcation theory. The basic knowledge required by this book is advanced calculus, functional analysis and qualitative theory of ordinary differential equations.
R 2,798.78
Applications of Vector Analysis and Complex Variables in Engineering
This textbook presents the application of mathematical methods and theorems tosolve engineering problems, rather than focusing on mathematical proofs. Applications of Vector Analysis and Complex Variables in Engineering explains the mathematical principles in a manner suitable for engineering students, who generally think quite differently than students of mathematics. The objective is to emphasize mathematical methods and applications, rather than emphasizing general theorems and principles, for which the reader is referred to the literature. Vector analysis plays an important role in engineering, and is presented in terms of indicial notation, making use of the Einstein summation convention. This text differs from most texts in that symbolic vector notation is completely avoided, as suggested in the textbooks on tensor algebra and analysis written in German by Duschek and Hochreiner, in the 1960s. The defining properties of vector fields, the divergence and curl, are introduced in terms of fluid mechanics. The integral theorems of Gauss (the divergence theorem), Stokes, and Green are introduced also in the context of fluid mechanics. The final application of vector analysis consists of the introduction of non-Cartesian coordinate systems with straight axes, the formal definition of vectors and tensors. The stress and strain tensors are defined as an application. Partial differential equations of the first and second order are discussed. Two-dimensional linear partial differential equations of the second order are covered, emphasizing the three types of equation: hyperbolic, parabolic, and elliptic. The hyperbolic partial differential equations have two real characteristic directions, and writing the equations along these directions simplifies the solution process. The parabolic partial differential equations have two coinciding characteristics; this gives useful information regarding the character of the equation, but does not help in solving problems. The elliptic partial differential equations do not have real characteristics. In contrast to most texts, rather than abandoning the idea of using characteristics, here the complex characteristics are determined, and the differential equations are written along these characteristics. This leads to a generalized complex variable system, introduced by Wirtinger. The vector field is written in terms of a complex velocity, and the divergence and the curl of the vector field is written in complex form, reducing both equations to a single one. Complex variable methods are applied to elliptical problems in fluid mechanics, and linear elasticity.The techniques presented for solving parabolic problems are the Laplace transform and separation of variables, illustrated for problems of heat flow and soil mechanics. Hyperbolic problems of vibrating strings and bars, governed by the wave equation are solved by the method of characteristics as well as by Laplace transform. The method of characteristics for quas
R 3,467.39
R 427.62
Course In Analysis, A - Vol. Ii: Differentiation And Integration Of Functions Of Several Variables, Vector Calculus
'The authors give many examples, illustrations and exercises to help students digest the theory and they employ use of clear and neat notation throughout. I really appreciate their selection of exercises, since many of the problems develop simple techniques to be used later in the book or make connections of analysis with other parts of mathematics. There are also solutions to all of the exercises in the back of the book. As in the first volume there are some real gems in volume II. A Course in Analysis seems to be full of these little gems where the authors use the material or ask the readers to use the material to obtain results or examples that the reader will certainly see again in another context later in their studies of mathematics. Generally, the quality of exposition in both of the first two volumes is very high. I recommend these books.' (See Full Review)MAA ReviewsThis is the second volume of 'A Course in Analysis' and it is devoted to the study of mappings between subsets of Euclidean spaces. The metric, hence the topological structure is discussed as well as the continuity of mappings. This is followed by introducing partial derivatives of real-valued functions and the differential of mappings. Many chapters deal with applications, in particular to geometry (parametric curves and surfaces, convexity), but topics such as extreme values and Lagrange multipliers, or curvilinear coordinates are considered too. On the more abstract side results such as the Stone-Weierstrass theorem or the Arzela-Ascoli theorem are proved in detail. The first part ends with a rigorous treatment of line integrals.The second part handles iterated and volume integrals for real-valued functions. Here we develop the Riemann (-Darboux-Jordan) theory. A whole chapter is devoted to boundaries and Jordan measurability of domains. We also handle in detail improper integrals and give some of their applications.The final part of this volume takes up a first discussion of vector calculus. Here we present a working mathematician's version of Green's, Gauss' and Stokes' theorem. Again some emphasis is given to applications, for example to the study of partial differential equations. At the same time we prepare the student to understand why these theorems and related objects such as surface integrals demand a much more advanced theory which we will develop in later volumes.This volume offers more than 260 problems solved in complete detail which should be of great benefit to every serious student.
R 5,107.01
Vector Bundles and Their Applications
In the last few years the use of geometrie methods has permeated many more branehes of mathematies and the seiences. Briefly its role may be eharaeterized as folIows. Whereas methods of mathematieal analysis deseribe phenomena 'in the sm all " geometrie methods eontribute to giving the picture 'in the large'. A seeond no less important property of geometrie methods is the eonvenienee of using its language to deseribe and give qualitative explanations for diverse mathematieal phenomena and patterns. From this point of view, the theory of veetor bundles together with mathematieal analysis on manifolds (global anal- ysis and differential geometry) has provided a major stimulus. Its language turned out to be extremely fruitful: connections on prineipal veetor bundles (in terms of whieh various field theories are deseribed), transformation groups including the various symmetry groups that arise in eonneetion with physieal problems, in asymptotie methods of partial differential equations with small parameter, in elliptie operator theory, in mathematieal methods of classieal meehanies and in mathematieal methods in eeonomies.There are other eur- rently less signifieant applieations in other fields. Over a similar period, uni- versity edueation has ehanged eonsiderably with the appearanee of new courses on differential geometry and topology. New textbooks have been published but 'geometry and topology' has not, in our opinion, been wen eovered from a prae- tieal applieations point of view.
R 3,032.01
R 1,605.98
Vector Variational Inequalities and Vector Equilibria
In the fifties and sixties, several real problems, old and new, especially in Physics, Mechanics, Fluidodynamics, Structural Engi- neering, have shown the need of new mathematical models for study- ing the equilibrium of a system. This has led to the formulation of Variational Inequalities (by G. Stampacchia), and to the develop- ment of Complementarity Systems (by W.S. Dorn, G.B. Dantzig, R.W. Cottle, O.L. Mangasarian et al.) with important applications in the elasto-plastic field (initiated by G. Maier). The great advan- tage of these models is that the equilibrium is not necessarily the extremum of functional, like energy, so that no such functional must be supposed to exist. In the same decades, in some fields like Control Theory, Net- works, Industrial Systems, Logistics, Management Science, there has been a strong request of mathmatical models for optimizing situa- tions where there are concurrent objectives, so that Vector Optimiza- tion (initiated by W. Pareto) has received new impetus. With regard to equilibrium problems, Vector Optimization has the above - mentioned drawback of being obliged to assume the exis- tence of a (vector) functional.Therefore, at the end of the seventies the study of Vector Variational Inequalities began with the scope of exploiting the advantages of both variational and vector models. This volume puts together most of the recent mathematical results in Vector Variational Inequalities with the purpose of contributing to further research.
R 6,040.65
Introductory Theory of Topological Vector SPates
This text offers an overview of the basic theories and techniques of functional analysis and its applications. It contains topics such as the fixed point theory starting from Ky Fan's KKM covering and quasi-Schwartz operators. It also includes over 200 exercises to reinforce important concepts.;The author explores three fundamental results on Banach spaces, together with Grothendieck's structure theorem for compact sets in Banach spaces (including new proofs for some standard theorems) and Helley's selection theorem. Vector topologies and vector bornologies are examined in parallel, and their internal and external relationships are studied. This volume also presents recent developments on compact and weakly compact operators and operator ideals; and discusses some applications to the important class of Schwartz spaces.;This text is designed for a two-term course on functional analysis for upper-level undergraduate and graduate students in mathematics, mathematical physics, economics and engineering. It may also be used as a self-study guide by researchers in these disciplines.
R 3,850.64
Recent Developments in Vector Optimization
We always come cross several decision-making problems in our daily life. Such problems are always conflicting in which many different view points should be satisfied. In politics, business, industrial systems, management science, networks, etc. one often encounters such kind of problems. The most important and difficult part in such problems is the conflict between various objectives and goals. In these problems, one has to find the minimum(or maximum) for several objective functions. Such problems are called vector optimization problems (VOP),multi-criteria optimization problems or multi-objective optimization problems. This volume deals with several different topics / aspects of vector optimization theory ranging from the very beginning to the most recent one. It contains fourteen chapters written by different experts in the field of vector optimization.
R 4,316.27
R 616.00
Quadratic Forms in Infinite Dimensional Vector Spaces
For about a decade I have made an effort to study quadratic forms in infinite dimensional vector spaces over arbitrary division rings. Here we present in a systematic fashion half of the results found du ring this period, to wit, the results on denumerably infinite spaces (" NO-forms'''). Certain among the results included here had of course been published at the time when they were found, others appear for the first time (the case, for example, in Chapters IX, X , XII where I in clude results contained in the Ph.D.theses by my students W. Allenspach, L. Brand, U. Schneider, M. Studer). If one wants to give an introduction to the geometric algebra of infinite dimensional quadratic spaces, a discussion of N-dimensional O spaces ideally serves the purpose. First, these spaces show a large number of phenomena typical of infinite dimensional spaces. Second, most proofs can be done by recursion which resembles the familiar pro cedure by induction in the finite dimensional situation. Third, the student acquires a good feeling for the linear algebra in infinite di mensions because it is impossible to camouflage problems by topological expedients (in dimension NO it is easy to see, in a given case, wheth er topological language is appropriate or not).
R 1,578.11
R 611.00
