Search results for "Vectorization"
Items we need to order for you
Vector-Valued Functions and their Applications
This book is the first to be devoted to the theory of vector-valued functions with one variable. This theory is one of the fundamental tools employed in modern physics, the spectral theory of operators, approximation of analytic operators, analytic mappings between vectors, and vector-valued functions of several variables. The book contains three chapters devoted to the theory of normal functions, Hp-space, and vector-valued functions and their applications. Among the topics dealt with are the properties of complex functions in a complex plane and infinite-dimensional spaces, and the solution of vector-valued integral equations and boundary value problems by complex analysis and functional analysis, which involve methods which can be applied to problems in operations research and control theory. Much original research is included. This volume will be of interest to those whose work involves complex analysis and control theory, and can be recommended as a graduate text in these areas.
R 3,079.83
Vector Control of Induction Machines
After a brief introduction to the main law of physics and fundamental concepts inherent in electromechanical conversion, Vector Control of Induction Machines introduces the standard mathematical models for induction machines – whichever rotor technology is used – as well as several squirrel-cage induction machine vector-control strategies. The use of causal ordering graphs allows systematization of the design stage, as well as standardization of the structure of control devices.Vector Control of Induction Machines suggests a unique approach aimed at reducing parameter sensitivity for vector controls based on a theoretical analysis of this sensitivity. This analysis naturally leads to the introduction of control strategies that are based on the combination of different controls with different robustness properties, through the use of fuzzy logic supervisors. Numerous applications and experiments confirm the validity of this simple solution, which is both reproducible and applicable to other complex systems.Vector Control of Induction Machines is written for researchers and postgraduate students in electrical engineering and motor drive design.
R 5,460.05
Geometric Multiplication of Vectors
This book enables the reader to discover elementary concepts of geometric algebra and its applications with lucid and direct explanations. Why would one want to explore geometric algebra? What if there existed a universal mathematical language that allowed one: to make rotations in any dimension with simple formulas, to see spinors or the Pauli matrices and their products, to solve problems of the special theory of relativity in three-dimensional Euclidean space, to formulate quantum mechanics without the imaginary unit, to easily solve difficult problems of electromagnetism, to treat the Kepler problem with the formulas for a harmonic oscillator, to eliminate unintuitive matrices and tensors, to unite many branches of mathematical physics? What if it were possible to use that same framework to generalize the complex numbers or fractals to any dimension, to play with geometry on a computer, as well as to make calculations in robotics, ray-tracing and brain science? In addition, what if such a language provided a clear, geometric interpretation of mathematical objects, even for the imaginary unit in quantum mechanics? Such a mathematical language exists and it is called geometric algebra. High school students have the potential to explore it, and undergraduate students can master it. The universality, the clear geometric interpretation, the power of generalizations to any dimension, the new insights into known theories, and the possibility of computer implementations make geometric algebra a thrilling field to unearth.
R 2,167.71
Introductory Theory of Topological Vector SPates
This text offers an overview of the basic theories and techniques of functional analysis and its applications. It contains topics such as the fixed point theory starting from Ky Fan's KKM covering and quasi-Schwartz operators. It also includes over 200 exercises to reinforce important concepts.;The author explores three fundamental results on Banach spaces, together with Grothendieck's structure theorem for compact sets in Banach spaces (including new proofs for some standard theorems) and Helley's selection theorem. Vector topologies and vector bornologies are examined in parallel, and their internal and external relationships are studied. This volume also presents recent developments on compact and weakly compact operators and operator ideals; and discusses some applications to the important class of Schwartz spaces.;This text is designed for a two-term course on functional analysis for upper-level undergraduate and graduate students in mathematics, mathematical physics, economics and engineering. It may also be used as a self-study guide by researchers in these disciplines.
R 3,850.64
Calculus with Vectors
Calculus with Vectors grew out of a strong need for a beginning calculus textbook for undergraduates who intend to pursue careers in STEM fields. The approach introduces vector-valued functions from the start, emphasizing the connections between one-variable and multi-variable calculus. The text includes early vectors and early transcendentals and includes a rigorous but informal approach to vectors. Examples and focused applications are well presented along with an abundance of motivating exercises.The approaches taken to topics such as the derivation of the derivatives of sine and cosine, the approach to limits and the use of "tables" of integration have been modified from the standards seen in other textbooks in order to maximize the ease with which students may comprehend the material. Additionally, the material presented is intentionally non-specific to any software or hardware platform in order to accommodate the wide variety and rapid evolution of tools used. Technology is referenced in the text and is required for a good number of problems.
R 2,931.00
Topological Vector Spaces
With many new concrete examples and historical notes, Topological Vector Spaces, Second Edition provides one of the most thorough and up-to-date treatments of the Hahn–Banach theorem. This edition explores the theorem’s connection with the axiom of choice, discusses the uniqueness of Hahn–Banach extensions, and includes an entirely new chapter on vector-valued Hahn–Banach theorems. It also considers different approaches to the Banach–Stone theorem as well as variations of the theorem.The book covers locally convex spaces; barreled, bornological, and webbed spaces; and reflexivity. It traces the development of various theorems from their earliest beginnings to present day, providing historical notes to place the results in context. The authors also chronicle the lives of key mathematicians, including Stefan Banach and Eduard Helly. Suitable for both beginners and experienced researchers, this book contains an abundance of examples, exercises of varying levels of difficulty with many hints, and an extensive bibliography and index.
R 3,114.00
Applications of Vector Analysis and Complex Variables in Engineering
This textbook presents the application of mathematical methods and theorems tosolve engineering problems, rather than focusing on mathematical proofs. Applications of Vector Analysis and Complex Variables in Engineering explains the mathematical principles in a manner suitable for engineering students, who generally think quite differently than students of mathematics. The objective is to emphasize mathematical methods and applications, rather than emphasizing general theorems and principles, for which the reader is referred to the literature. Vector analysis plays an important role in engineering, and is presented in terms of indicial notation, making use of the Einstein summation convention. This text differs from most texts in that symbolic vector notation is completely avoided, as suggested in the textbooks on tensor algebra and analysis written in German by Duschek and Hochreiner, in the 1960s. The defining properties of vector fields, the divergence and curl, are introduced in terms of fluid mechanics. The integral theorems of Gauss (the divergence theorem), Stokes, and Green are introduced also in the context of fluid mechanics. The final application of vector analysis consists of the introduction of non-Cartesian coordinate systems with straight axes, the formal definition of vectors and tensors. The stress and strain tensors are defined as an application. Partial differential equations of the first and second order are discussed. Two-dimensional linear partial differential equations of the second order are covered, emphasizing the three types of equation: hyperbolic, parabolic, and elliptic. The hyperbolic partial differential equations have two real characteristic directions, and writing the equations along these directions simplifies the solution process. The parabolic partial differential equations have two coinciding characteristics; this gives useful information regarding the character of the equation, but does not help in solving problems. The elliptic partial differential equations do not have real characteristics. In contrast to most texts, rather than abandoning the idea of using characteristics, here the complex characteristics are determined, and the differential equations are written along these characteristics. This leads to a generalized complex variable system, introduced by Wirtinger. The vector field is written in terms of a complex velocity, and the divergence and the curl of the vector field is written in complex form, reducing both equations to a single one. Complex variable methods are applied to elliptical problems in fluid mechanics, and linear elasticity.The techniques presented for solving parabolic problems are the Laplace transform and separation of variables, illustrated for problems of heat flow and soil mechanics. Hyperbolic problems of vibrating strings and bars, governed by the wave equation are solved by the method of characteristics as well as by Laplace transform. The method of characteristics for quas
R 3,467.39
Topological Vector Spaces and Their Applications
This book gives a compact exposition of the fundamentals of the theory of locally convex topological vector spaces. Furthermore it contains a survey of the most important results of a more subtle nature, which cannot be regarded as basic, but knowledge which is useful for understanding applications. Finally, the book explores some of such applications connected with differential calculus and measure theory in infinite-dimensional spaces. These applications are a central aspect of the book, which is why it is different from the wide range of existing texts on topological vector spaces. Overall, this book develops differential and integral calculus on infinite-dimensional locally convex spaces by using methods and techniques of the theory of locally convex spaces. The target readership includes mathematicians and physicists whose research is related to infinite-dimensional analysis.
R 3,873.44
Set Optimization and Applications - The State of the Art
This volume presents five surveys with extensivebibliographies and six original contributions on set optimization and its applicationsin mathematical finance and game theory. The topics range from moreconventional approaches that look for minimal/maximal elements with respect tovector orders or set relations, to the new complete-lattice approach thatcomprises a coherent solution concept for set optimization problems, along withexistence results, duality theorems, optimality conditions, variationalinequalities and theoretical foundations for algorithms. Modern approaches toscalarization methods can be found as well as a fundamental contribution to conditionalanalysis. The theory is tailor-made for financial applications, in particular riskevaluation and [super-]hedging for market models with transaction costs, but italso provides a refreshing new perspective on vector optimization. There is nocomparable volume on the market, making the book an invaluable resource forresearchers working in vector optimization and multi-criteria decision-making, mathematicalfinance and economics as well as [set-valued] variational analysis.
R 4,279.86
R 387.00
Viral Vector Approaches in Neurobiology and Brain Diseases
Aiming toward improvement in the safety, efficiency, and specificity of viral vectors for neurobiological research and clinical applications, Viral Vector Approaches in Neurobiology and Brain Diseases covers key aspects related to the use of viral vectors in neuroscience, with a major emphasis on basic mechanisms of synaptic plasticity, learning, and memory, as well as molecular neuropharmacology and experimental animal models of brain disorders. The volume begins by delving into features of the viral vectors currently available in neuroscience and their production methods, and it then continues onward to examples of successful applications of viral vector technology to psychiatric and memory research, current applications of viral vector technology in the context of neurological disorders, as well as various cutting-edge applications of viral vector technology to neuroscience, including optogenetics. Written for the Neuromethods series, the chapters of this book contain the kind of detailed description and implementation advice that promotes successful, repeatable results. Practical and up to date, Viral Vector Approaches in Neurobiology and Brain Diseases will be useful not only to neurobiologists wishing to routinely use viral vectors in the laboratory but also to experienced scientists needing detailed new protocols for a variety of experimental applications.
R 4,825.63
R 886.00
R 427.62
R 455.00
Course In Analysis, A - Vol. Ii: Differentiation And Integration Of Functions Of Several Variables, Vector Calculus
'The authors give many examples, illustrations and exercises to help students digest the theory and they employ use of clear and neat notation throughout. I really appreciate their selection of exercises, since many of the problems develop simple techniques to be used later in the book or make connections of analysis with other parts of mathematics. There are also solutions to all of the exercises in the back of the book. As in the first volume there are some real gems in volume II. A Course in Analysis seems to be full of these little gems where the authors use the material or ask the readers to use the material to obtain results or examples that the reader will certainly see again in another context later in their studies of mathematics. Generally, the quality of exposition in both of the first two volumes is very high. I recommend these books.' (See Full Review)MAA ReviewsThis is the second volume of 'A Course in Analysis' and it is devoted to the study of mappings between subsets of Euclidean spaces. The metric, hence the topological structure is discussed as well as the continuity of mappings. This is followed by introducing partial derivatives of real-valued functions and the differential of mappings. Many chapters deal with applications, in particular to geometry (parametric curves and surfaces, convexity), but topics such as extreme values and Lagrange multipliers, or curvilinear coordinates are considered too. On the more abstract side results such as the Stone-Weierstrass theorem or the Arzela-Ascoli theorem are proved in detail. The first part ends with a rigorous treatment of line integrals.The second part handles iterated and volume integrals for real-valued functions. Here we develop the Riemann (-Darboux-Jordan) theory. A whole chapter is devoted to boundaries and Jordan measurability of domains. We also handle in detail improper integrals and give some of their applications.The final part of this volume takes up a first discussion of vector calculus. Here we present a working mathematician's version of Green's, Gauss' and Stokes' theorem. Again some emphasis is given to applications, for example to the study of partial differential equations. At the same time we prepare the student to understand why these theorems and related objects such as surface integrals demand a much more advanced theory which we will develop in later volumes.This volume offers more than 260 problems solved in complete detail which should be of great benefit to every serious student.
R 2,904.52
Freeform Vector Diffraction Theory
Freeform Vector Diffraction Theory traces the conceptual journey from classical scalar diffraction to a rigorous and generalized framework for computing the vector diffraction patterns of arbitrary freeform wavefronts and complex, spatially varying polarization states.Readers will gain a unified theoretical perspective that enables accurate prediction of electromagnetic field behavior in high-numerical-aperture systems and modern non-conventional optics. The book delivers these fundamental insights through detailed mathematical and geometrical toolkits, including vector calculus and Zernike polynomials, which facilitate rigorous derivations of the generalized Richards-Wolf integrals in both cylindrical and Cartesian coordinates. It also explores key practical applications in fields such as super-resolution microscopy, advanced lithography, and optical trapping. Through in-depth analysis of apodization functions and the response of radially, azimuthally, and linearly polarized light, readers will learn to precisely characterize complex optical systems affected by significant aberrations.This work is an indispensable resource for leading researchers, optical design engineers, and graduate students in optics and photonics who seek to accurately model non-stigmatic and aberrated systems. The text clearly sets itself apart from other treatises on the subject by moving beyond the classical assumptions of spherical and ideal wavefronts typical of traditional theories. Instead, it offers a robust analytical framework for freeform surfaces and complex vectorial beams encountered in today’s technology. By masterfully integrating concepts such as the Malus-Dupin theorem and the angular spectrum representation, the book equips professionals with the essential tools to analyze the vector nature of light and optimize optical instruments in an era where structured light continues to reveal profound new insights into the electromagnetic nature of radiation.
R 6,118.00
Recent Developments in Vector Optimization
We always come cross several decision-making problems in our daily life. Such problems are always conflicting in which many different view points should be satisfied. In politics, business, industrial systems, management science, networks, etc. one often encounters such kind of problems. The most important and difficult part in such problems is the conflict between various objectives and goals. In these problems, one has to find the minimum(or maximum) for several objective functions. Such problems are called vector optimization problems (VOP),multi-criteria optimization problems or multi-objective optimization problems. This volume deals with several different topics / aspects of vector optimization theory ranging from the very beginning to the most recent one. It contains fourteen chapters written by different experts in the field of vector optimization.
R 4,316.27
R 1,171.00
Vector Coherent State Method and Its Application to Problems of Higher Symmetries
These lectures review the recently developed vector coherent state method. The book is an excellent introduction to the field because of the many examples treated in detail, in particular those from nuclear and particle physics. These calculations will be welcomed by researchers and graduate students. The author reviews the concepts of coherent states of the Heisenberg algebra and shows then that the vector coherent state method maps the higher symmetry algebra into an n-dimensional harmonic oscillator algebra coupled with a simple intrinsic symmetry algebra. The formulation involves some vector (or analogous higher symmetry) coupling of the intrinsic algebra with the n-dimensional oscillator algebra, leading to matrix representations and Wigner coefficients of the higher symmetry algebra expressed in terms of simple calculable functions and recoupling coefficients for the simpler intrinsic algebra.
R 1,593.16
Topological Vector Spaces
Intended as a systematic text on topological vector spaces, this text assumes familiarity with the elements of general topology and linear algebra. Similarly, the elementary facts on Hilbert and Banach spaces are not discussed in detail here, since the book is mainly addressed to those readers who wish to go beyond the introductory level. Each of the chapters is preceded by an introduction and followed by exercises, which in turn are devoted to further results and supplements, in particular, to examples and counter-examples, and hints have been given where appropriate. This second edition has been thoroughly revised and includes a new chapter on C^* and W^* algebras.
R 2,240.15
Guiding Vector Fields for Robot Motion Control
Using a designed vector field to guide robots to follow a given geometric desired path has found a range of practical applications, such as underwater pipeline inspection, warehouse navigation, and highway traffic monitoring. It is thus in great need to build a rigorous theory to guide practical implementations with formal guarantees. It is even so when multiple robots are required to follow predefined desired paths or maneuver on surfaces and coordinate their motions to efficiently accomplish repetitive and laborious tasks.The book introduces guiding vector fields on Euclidean spaces and Riemannian manifolds for single-robot and multi-robot path-following and motion coordination, provides rigorous theoretical guarantees of vector field guided motion control of robotic systems, and elaborates on the practical implementation of the proposed algorithms on mobile wheeled robots and fixed-wing aircraft. It provides guidelines for the robust, reliable, and safe practical implementations for robotic tasks, including path-following navigation, obstacle-avoidance, and multi-robot motion coordination.In particular, the book reveals fundamental theoretic underpinnings of guiding vector fields and applies to addressing various robot motion control problems. Notably, it answers many crucial and challenging questions such as:· How to generate a general guiding vector field on any n-dimensional Riemannian manifold for robot motion control tasks?· Do singular points always exist in a general guiding vector field?· How to generate a guiding vector field that is free of singular points?· How to design control algorithms based on guiding vector fields for different robot motion control tasks including path-following, obstacle-avoidance, and multi-robot distributed motion coordination?Answering these questions has led to the discovery of fundamental assumptions, a “topological surgery” to create a singularity-free guiding vector field, a robot navigation algorithm with the global convergence property, a provably safe collision-avoidance algorithm and an effective distributed motion control algorithm, etc
R 4,453.62
Linearization of Nonlinear Control Systems
This textbook helps graduate level student to understand easily the linearization of nonlinear control system. Differential geometry is essential to understand the linearization problems of the control nonlinear systems. In this book, the basics of differential geometry needed in linearization are explained on the Euclidean space instead of the manifold for students who are not accustomed to differential geometry. Many Lie algebra formulas, used often in linearization, are also provided with proof. The conditions in the linearization problems are complicated to check because the Lie bracket calculation of vector fields by hand needs much concentration and time. This book provides MATLAB programs for most of the theorems. The book also includes end-of-chapter problems and other pedagogical aids to help understanding and self study.
R 3,086.24
Solutions Manual to accompany Analysis in Vector Spaces
A rigorous introduction to calculus in vector spaces The concepts and theorems of advanced calculus combined with related computational methods are essential to understanding nearly all areas of quantitative science. Analysis in Vector Spaces presents the central results of this classic subject through rigorous arguments, discussions, and examples. The book aims to cultivate not only knowledge of the major theoretical results, but also the geometric intuition needed for both mathematical problem-solving and modeling in the formal sciences. The authors begin with an outline of key concepts, terminology, and notation and also provide a basic introduction to set theory, the properties of real numbers, and a review of linear algebra. An elegant approach to eigenvector problems and the spectral theorem sets the stage for later results on volume and integration. Subsequent chapters present the major results of differential and integral calculus of several variables as well as the theory of manifolds. Additional topical coverage includes: Sets and functionsReal numbersVector functionsNormed vector spacesFirst- and higher-order derivativesDiffeomorphisms and manifoldsMultiple integralsIntegration on manifoldsStokes' theoremBasic point set topology Numerous examples and exercises are provided in each chapter to reinforce new concepts and to illustrate how results can be applied to additional problems. Furthermore, proofs and examples are presented in a clear style that emphasizes the underlying intuitive ideas. Counterexamples are provided throughout the book to warn against possible mistakes, and extensive appendices outline the construction of real numbers, include a fundamental result about dimension, and present general results about determinants. Assuming only a fundamental understanding of linear algebra and single variable calculus, Analysis in Vector Spaces is an excellent book for a second course in analysis for mathematics, physics, computer science, and engineering majors at the undergraduate and graduate levels. It also serves as a valuable reference for further study in any discipline that requires a firm understanding of mathematical techniques and concepts.
R 1,497.00
R 428.00
R 524.00
R 519.00
Vector Calculus
INTRODUCTION. In course of an attempt to apply direct vector methods to certain problems of Electricity and Hydrodynamics, it was felt that, at least as a matter of consistency, the foundations of Vector Analysis ought to be placed on a basis independent of any reference to cartesian coordinates and the main theorems of that Analysis established directly from first principles. embodied in the present paper and an attempt is made here to develop the Differential and Integral Calculus of Vectors from a point of view which is believed to be new. In order to realise the special features of my presentation of the subject, it will be convenient to recall briefly the usual method of treatment. In any vector problem we are given certain relations among a number of vectors and we have to deduce some other relations which these same vectors satisfy.
R 310.00
Vector Partitions, Visible Points and Ramanujan Functions
Vector Partitions, Visible Points and Ramanujan Functions offers a novel theory of Vector Partitions, though very much grounded in the long-established work of others, that could be developed as an extension to the existing theory of Integer Partitions. The book is suitable for graduate students in physics, applied mathematics, number theory and computational mathematics. It takes the reader up to research level, presenting new results alongside known classical results from integer partitions and areas of vector and multipartite partition theory. It also sets forth new directions for research for the more advanced reader.Above all, the intention of the book is to bring new inspiration to others who study mathematics and related areas. It is hoped that some new ideas will be launched to add value and insight into many of the classical and new theories surrounding partitions. The book is an appreciation of the many gifted authors of research into partitions over the past century and before, in the hope that more may come of this for future generations.FeaturesProvides a step-by-step guide through the known literature on Integer and Vector Partitions, and a focus on the not so well-known Visible Point Vector identitiesServes as a reference for graduate students and researchers in physics, applied mathematics, number theory and computational mathematicsOffers a variety of practical examples as well as sets of exercises suitable for students and researchers.
R 9,158.00
Finite Dimensional Vector Spaces. (AM-7), Volume 7
As a newly minted Ph.D., Paul Halmos came to the Institute for Advanced Study in 1938--even though he did not have a fellowship--to study among the many giants of mathematics who had recently joined the faculty. He eventually became John von Neumann's research assistant, and it was one of von Neumann's inspiring lectures that spurred Halmos to write Finite Dimensional Vector Spaces. The book brought him instant fame as an expositor of mathematics. Finite Dimensional Vector Spaces combines algebra and geometry to discuss the three-dimensional area where vectors can be plotted. The book broke ground as the first formal introduction to linear algebra, a branch of modern mathematics that studies vectors and vector spaces. The book continues to exert its influence sixty years after publication, as linear algebra is now widely used, not only in mathematics but also in the natural and social sciences, for studying such subjects as weather problems, traffic flow, electronic circuits, and population genetics.In 1983 Halmos received the coveted Steele Prize for exposition from the American Mathematical Society for "his many graduate texts in mathematics dealing with finite dimensional vector spaces, measure theory, ergodic theory, and Hilbert space."
R 3,185.32
R 275.00
Finite-Dimensional Vector Spaces
From the reviews: "The theory is systematically developed by the axiomatic method that has, since von Neumann, dominated the general approach to linear functional analysis and that achieves here a high degree of lucidity and clarity....The book contains about 350 well placed and instructive problems, which cover a considerable part of the subject. All in all this is an excellent work, of equally high value for both student and teacher." --ZENTRALBLATT FÜR MATHEMATIK
R 1,675.32
Nonsmooth Vector Functions and Continuous Optimization
Focusing on the study of nonsmooth vector functions, this book presents a comprehensive account of the calculus of generalized Jacobian matrices and their applications to continuous nonsmooth optimization problems, as well as variational inequalities in finite dimensions. The treatment is motivated by a desire to expose an elementary approach to nonsmooth calculus, using a set of matrices to replace the nonexistent Jacobian matrix of a continuous vector function.
R 3,033.78
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa- tion for activation of lymphokine genes.To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 * -96 -84 GGAGATTCCCC IL-2R (p55) ...
R 3,238.05
R 916.00
Introduction to Parallel and Vector Scientific Computation
In this text, students of applied mathematics, science and engineering are introduced to fundamental ways of thinking about the broad context of parallelism. The authors begin by giving the reader a deeper understanding of the issues through a general examination of timing, data dependencies, and communication. These ideas are implemented with respect to shared memory, parallel and vector processing, and distributed memory cluster computing. Threads, OpenMP, and MPI are covered, along with code examples in Fortran, C, and Java. The principles of parallel computation are applied throughout as the authors cover traditional topics in a first course in scientific computing. Building on the fundamentals of floating point representation and numerical error, a thorough treatment of numerical linear algebra and eigenvector/eigenvalue problems is provided. By studying how these algorithms parallelize, the reader is able to explore parallelism inherent in other computations, such as Monte Carlo methods.
R 3,223.65
R 611.00
Linearization of Nonlinear Control Systems
This textbook helps graduate level student to understand easily the linearization of nonlinear control system. Differential geometry is essential to understand the linearization problems of the control nonlinear systems. In this book, the basics of differential geometry needed in linearization are explained on the Euclidean space instead of the manifold for students who are not accustomed to differential geometry. Many Lie algebra formulas, used often in linearization, are also provided with proof. The conditions in the linearization problems are complicated to check because the Lie bracket calculation of vector fields by hand needs much concentration and time. This book provides MATLAB programs for most of the theorems. The book also includes end-of-chapter problems and other pedagogical aids to help understanding and self study.
R 2,817.74
R 1,331.85
Vector Bundles and Their Applications
In the last few years the use of geometrie methods has permeated many more branehes of mathematies and the seiences. Briefly its role may be eharaeterized as folIows. Whereas methods of mathematieal analysis deseribe phenomena 'in the sm all " geometrie methods eontribute to giving the picture 'in the large'. A seeond no less important property of geometrie methods is the eonvenienee of using its language to deseribe and give qualitative explanations for diverse mathematieal phenomena and patterns. From this point of view, the theory of veetor bundles together with mathematieal analysis on manifolds (global anal- ysis and differential geometry) has provided a major stimulus. Its language turned out to be extremely fruitful: connections on prineipal veetor bundles (in terms of whieh various field theories are deseribed), transformation groups including the various symmetry groups that arise in eonneetion with physieal problems, in asymptotie methods of partial differential equations with small parameter, in elliptie operator theory, in mathematieal methods of classieal meehanies and in mathematieal methods in eeonomies.There are other eur- rently less signifieant applieations in other fields. Over a similar period, uni- versity edueation has ehanged eonsiderably with the appearanee of new courses on differential geometry and topology. New textbooks have been published but 'geometry and topology' has not, in our opinion, been wen eovered from a prae- tieal applieations point of view.
R 3,032.01
Calculus in Vector Spaces, Revised Expanded
Calculus in Vector Spaces addresses linear algebra from the basics to the spectral theorem and examines a range of topics in multivariable calculus. This second edition introduces, among other topics, the derivative as a linear transformation, presents linear algebra in a concrete context based on complementary ideas in calculus, and explains differential forms on Euclidean space, allowing for Green's theorem, Gauss's theorem, and Stokes's theorem to be understood in a natural setting. Mathematical analysts, algebraists, engineers, physicists, and students taking advanced calculus and linear algebra courses should find this book useful.
R 7,689.09
Vector Control of Induction Machines
After a brief introduction to the main law of physics and fundamental concepts inherent in electromechanical conversion, Vector Control of Induction Machines introduces the standard mathematical models for induction machines – whichever rotor technology is used – as well as several squirrel-cage induction machine vector-control strategies. The use of causal ordering graphs allows systematization of the design stage, as well as standardization of the structure of control devices.Vector Control of Induction Machines suggests a unique approach aimed at reducing parameter sensitivity for vector controls based on a theoretical analysis of this sensitivity. This analysis naturally leads to the introduction of control strategies that are based on the combination of different controls with different robustness properties, through the use of fuzzy logic supervisors. Numerous applications and experiments confirm the validity of this simple solution, which is both reproducible and applicable to other complex systems.Vector Control of Induction Machines is written for researchers and postgraduate students in electrical engineering and motor drive design.
R 5,175.15
P-Vector Inverse Method
A major task for physical oceanographers is to determine the movement of oceanic water from observations. This book introduces the P-vector inverse method, with a two-step determination of the velocity from hydrographic data. The book provide insights into the basics of the P-vector inverse method and the features of the inverted global and regional ocean circulations. Upper undergraduate and graduate students as well as oceanographers, marine biologists and other environmental scientists will find this book a valuable tool for their studies.
R 3,089.64
Scalarization and Separation by Translation Invariant Functions
Like norms, translation invariant functions are a natural and powerful tool for the separation of sets and scalarization. This book provides an extensive foundation for their application. It presents in a unified way new results as well as results which are scattered throughout the literature. The functions are defined on linear spaces and can be applied to nonconvex problems. Fundamental theorems for the function class are proved, with implications for arbitrary extended real-valued functions. The scope of applications is illustrated by chapters related to vector optimization, set-valued optimization, and optimization under uncertainty, by fundamental statements in nonlinear functional analysis and by examples from mathematical finance as well as from consumer and production theory. The book is written for students and researchers in mathematics and mathematical economics. Engineers and researchers from other disciplines can benefit from the applications, for example from scalarization methods for multiobjective optimization and optimal control problems.
R 4,617.11
R 554.00
